RNA Encoder

Using the properties of translation in order to create a one way encoding system.

This program uses the properties of RNA Translation in order to create a one way encoding system that can be used for encryption.  

IDEA

1. The input string consists of one-byte characters. An example is "asdfasdf"
2. Each character is changed into  a 8-digit binary string. The example string, in this case, is changed into "0110000101110011011001000110011001100001011100110110010001100110".
3. Every two digit is viewed and changed into an RNA base, A G C or U. The example string is changed into "GCAGGUAUGCGAGCGCGCAGGUAUGCGAGCGC".
4. 3 RNA bases are grabbed in order to create one amino-acid. The example string becomes "Ala-Gly-Met-Arg-Ala-Arg-Arg-Tyr-Ala-Ser".

*at steps 3—>4, multiple RNA arrangements leads to one amino acid, which makes the original string unable to be guessed. Conduct steps 1-4 in order to compare an inputted string with the original password.

TESTING

a) same string

b) different string

LIMITATIONS

Since multiple arrangements lead to one amino acid, various strings lead to one encrypted passage. This causes wrong passwords to be thought correct and don't get rejected.

Here's an example. Suppose that we have two strings, "asdfasdf" and "asdfasda". Each string becomes "Ala-Gly-Met-Arg-Ala-Arg-Arg-Tyr-Ala-Ser" and "Ala-Gly-Met-Arg-Ala-Arg-Arg-Tyr-Ala-Ser", respectively. Notice that both strings are the same, and thus the program concludes that the inputted string is correct.